Mouse Epigenetic Clock trimming
The option --clock trims reads in a specific way that is currently used for the Mouse Epigenetic Clock (see here: Multi-tissue DNA methylation age predictor in mouse, Stubbs et al., Genome Biology, 2017 18:68). Following the trimming, Trim Galore exits.
In its current implementation, the dual-UMI RRBS reads come in the following format:
Read 1 5' UUUUUUUU CAGTA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF TACTG UUUUUUUU 3'Read 2 3' UUUUUUUU GTCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF ATGAC UUUUUUUU 5'Where UUUUUUUU is a random 8-mer unique molecular identifier (UMI), CAGTA is a constant region, and FFFFFFF... is the actual RRBS-Fragment to be sequenced. The UMIs for Read 1 (R1) and Read 2 (R2), as well as the fixed sequences (F1 or F2), are written into the read ID and removed from the actual sequence. Here is an example:
R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0: CGATGTTT ATCTAGTTCAGTACGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTGR2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0: CGATGTTT CAATTTTGCAGTACAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAA
R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0: CGATGTTT:R1:ATCTAGTT:R2:CAATTTTG:F1:CAGT:F2:CAGT CGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTGR2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0: CGATGTTT:R1:ATCTAGTT:R2:CAATTTTG:F1:CAGT:F2:CAGT CAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAAFollowing clock trimming, the resulting files (.clock_UMI.R1.fq(.gz) and .clock_UMI.R2.fq(.gz)) should be adapter- and quality-trimmed with a second Trim Galore run. Even though the data is technically RRBS, it doesn't require the --rrbs option. Instead the reads need to be trimmed by 15 bp from their 3' end to get rid of potential UMI and fixed sequences. For a single sample:
trim_galore --paired --three_prime_clip_R1 15 --three_prime_clip_R2 15 sample.clock_UMI.R1.fq.gz sample.clock_UMI.R2.fq.gzFor multiple samples, --paired requires input files in pairwise (R1, R2, R1, R2, …) order. Don't use *R1.fq.gz *R2.fq.gz globs which produce all-R1s-then-all-R2s. Either invoke once per sample, or interleave explicitly.
Following this, reads should be aligned with Bismark and deduplicated with UmiBam in --dual_index mode (see here: https://github.com/FelixKrueger/Umi-Grinder). UmiBam recognises the UMIs within this pattern: R1:(ATCTAGTT):R2:(CAATTTTG): as UMI R1 = ATCTAGTT and UMI R2 = CAATTTTG.
Multi-pair input
Section titled “Multi-pair input”Since v2.1.0-beta.4, --clock itself also accepts any even number of inputs as consecutive R1/R2 pairs (rather than only "exactly 2 files"):
trim_galore --clock A_R1.fq.gz A_R2.fq.gz B_R1.fq.gz B_R2.fq.gzEach pair gets a header (=== Clock pair N of M ===) and the same output-collision pre-flight that --paired runs.